| Types | DnaRegion
|
| Roles | Coding
CDS
|
| Sequences | BBa_K851001_sequence (Version 1)
|
Description
p4 [1] is a transcriptional regulator from the Bacillus subtilis phage ϕ(phi)29 [2]. It activates the transcription of phage ϕ29 A3 promoter and represses the transcription of phage ϕ29 A2b and A2c promoters.
BIOLOGY
It plays a major role in the transcriptional switch that divides bacteriophage ϕ29 infection in early and late phases with the control of early promoters A2b, A2c and late promoter A3[3,4].
In vivo, the synthesis of p4 is required for the activation of late promoter A3 and for the repression of early promoters A2b and A2c [5, 6]. In vitro, protein p4 activates transcription from the late promoter A3 by stabilizing σ^A-RNAP at the promoter [7, 8].
Protein p4 is a dimer of two identical subunits of 124 amino acids; it has no sequence homology with other proteins, except for the corresponding proteins of the bacteriophage ϕ29 family.
In the 3D structure (Fig. 3a), each monomer (45*20*20 ??^3) has central five-stranded antiparallel β-sheets, four α-helices and one 3_10-helix[9] .
For iGEM UNAM Genomics M??xico 2012 project [10], p4 was used in the design of an OR logic gate[11] using a recently described new type of communication system between Bacillus Subtilis cells called Nanotubes[12].
p4 was obtained from the plasmid PRMn25(Amp100 resistance) used in [13, 14]Rojo et al. 1990 and Garmend??a et al. 1988 as described in [15].
Notes
P4 5'-3'
PREFIX+RBS+SPACER+P4
upper
GTTTCTTCGAATTCGCGGCCGCTTCTAGAG AAAGGTGGTGAA TACTAG ATGCCTAAAACACAA
SUFIX+P4
lower 5'-3'
GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTA CTACACCATACTTTT
Source
REFERENCES
[1]http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=Retrieve&dopt=full_report&list_uids=6446523
[2] http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10756
[3] Camacho A & Salas M (2010) DNA bending and looping in the transcriptional control of bacteriophage ϕ29. FEMS Microbiol Rev. 34(5):828-841.
[4] Rojo F, Menc??a M, Monsalve M & Salas M (1998) Transcription activation and repression by interaction of a regulator with the a subunit of RNA polymerase: the model of phage ϕ29 protein p4. Nucleic Acid Re 60: 29???46.
[5] Monsalve M, Menc??a M, Rojo F & Salas M (1995) Transcription regulation in Bacillus subtilis phage ϕ29: expression of the viral promoters throughout the infection cycle. Virology 207: 23???31.
[6] Nuez B, Rojo F & SalasM(1992) Phage ϕ29 regulatory protein p4 stabilizes the binding of the RNA polymerase to the late promoter in a process involving direct protein???protein contact. P Natl Acad Sci USA 89: 11401???11405.
[7] Barthelemy I & Salas M (1989) Characterization of a new prokaryotic transcriptional activator and its DNA recognition site. J Mol Biol 208: 225???232.
[8] Nuez B, Rojo F & SalasM(1992) Phage ϕ29 regulatory protein p4 stabilizes the binding of the RNA polymerase to the late promoter in a process involving direct protein???protein contact. P Natl Acad Sci USA 89: 11401???11405.
[9] Badia D, Camacho A, P??rez-Lago L, Escand??n C, Salas M & Coll M (2006) The structure of phage ϕ29 transcription regulator p4???DNA complex reveals an N-hook motif for DNA. Mol Cell 22: 73???81.
[10] http://2012.igem.org/Team:UNAM_Genomics_Mexico
[11] http://2012.igem.org/Team:UNAM_Genomics_Mexico/Project/Description
[12] Dubey GP, Ben-Yehuda S. (2011) Intercellular nanotubes mediate bacterial communication. Cell.;144(4) :590-600
[13] Rojo F, Zaballos A & Salas M (1990) Bend induced by the phage ϕ29 transcriptional activator in the viral late promoter is required for activation. J Mol Biol 211: 713???725.
[14]Garmend??a C, Salas M & MHermoso J (1988) Site-directed mutagenesis in the DNA linking site of bacteriophage ϕ29 terminal protein: isolation and characterization of a Ser232 - Thr mutant. Nucleic Acid Re 16(13):5727-5740.