| Types | DnaRegion
|
| Roles | CDS
Coding
|
| Sequences | BBa_K284025_sequence (Version 1)
|
Description
The colicin CeaB belong to the colicin E2 operon. The activity spectrum of colicin E2 is restricted to gram-negative bacteria that produce the outer membrane protein BtuB, the E group colicin receptor. Colicin E2 has endodeoxyribonuclease activity, and DNA degradation eventually leads to the death of the affected cell.
Notes
The part was separated from the BBa_K131009 biobrick utilizing the primers below:
VF2 5??? tgccacctgacgtctaagaa 3???
Col-R ??? 5??? ccagaaattcagcctcggta 3???
Source
This part was separated from BBa_K131009, designed by Kevin McLeod, Group: iGEM08_Calgary_Wetware, which is the operon E2.