##gff-version 3 ##sequence-region BBa_Q200514 1 505 BBa_Q200514 . promoter 434 505 . + 0 ID=BBa_R2114;Name=BBa_R2114 BBa_Q200514 . operator 486 486 . + 0 ID=annotation1904661;Name=transcription start site;Parent=BBa_R2114 BBa_Q200514 . operator 456 467 . + 0 ID=annotation1904662;Name=C2003 operator site;Parent=BBa_R2114 BBa_Q200514 . promoter 450 455 . + 0 ID=annotation1904660;Name=-35 site;Parent=BBa_R2114 BBa_Q200514 . promoter 473 478 . + 0 ID=annotation1904659;Name=-10 site;Parent=BBa_R2114 BBa_Q200514 . ribosome_entry_site 1 15 . + 0 ID=BBa_B0030;Name=BBa_B0030 BBa_Q200514 . engineered_region 1 15 . + 0 ID=annotation7025;Name=BBa_B0030;Parent=BBa_B0030 BBa_Q200514 . ribosome_entry_site 8 12 . + 0 ID=annotation1702;Name=RBS;Parent=BBa_B0030 BBa_Q200514 . ribosome_entry_site 1 15 . + 0 ID=annotation1701;Name=RBS-1\Strong;Parent=BBa_B0030 BBa_Q200514 . terminator 297 376 . + 0 ID=BBa_B0010;Name=BBa_B0010 BBa_Q200514 . stem_loop 308 351 . + 0 ID=annotation4184;Name=stem_loop;Parent=BBa_B0010 BBa_Q200514 . engineered_region 297 376 . + 0 ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010 BBa_Q200514 . CDS 22 288 . + 0 ID=BBa_C2005;Name=BBa_C2005 BBa_Q200514 . non_covalent_binding_site 25 111 . + 0 ID=annotation1903902;Name=finger 2 of Zif268;Parent=BBa_C2005 BBa_Q200514 . start_codon 22 24 . + 0 ID=annotation1903904;Name=start codon;Parent=BBa_C2005 BBa_Q200514 . non_covalent_binding_site 187 282 . + 0 ID=annotation1903906;Name=GCN4 leucine zipper homodimerization domain;Parent=BBa_C2005 BBa_Q200514 . sequence_feature 172 186 . + 0 ID=annotation1903905;Name=domain linker;Parent=BBa_C2005 BBa_Q200514 . stop_codon 283 288 . + 0 ID=annotation1903907;Name=double stop codon;Parent=BBa_C2005 BBa_Q200514 . CDS 22 288 . + 0 ID=annotation1903901;Name=Zif268.GCN4;Parent=BBa_C2005 BBa_Q200514 . non_covalent_binding_site 112 171 . + 0 ID=annotation1903903;Name=finger 3 of Zif268;Parent=BBa_C2005 BBa_Q200514 . terminator 385 425 . + 0 ID=BBa_B0012;Name=BBa_B0012 BBa_Q200514 . stem_loop 392 411 . + 0 ID=annotation1686;Name=T7 TE;Parent=BBa_B0012 BBa_Q200514 . polyA_site 412 425 . + 0 ID=annotation1690;Name=polya;Parent=BBa_B0012 BBa_Q200514 . stop_codon 418 418 . + 0 ID=annotation1687;Name=stop;Parent=BBa_B0012 BBa_Q200514 . engineered_region 385 425 . + 0 ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012 >BBa_Q200514 attaaagaggagaaatactagatgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctga ccacccacatccgtacccacaccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacga acgtaaacgtcaccgtaaattgcagcacatgaaacagctggaagacaaagttgaagaactgctgtccaaaaactaccac ctggaaaacgaagttgctcgtctgaaaaaactggttggtgaacgttaataatactagagccaggcatcaaataaaacga aaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggct caccttcgggtgggcctttctgcgtttatatactagagtttatcaaaaagagtgttgactcccacgcgtgggaatagga tatttagattcataaatttgagagaggagtt