##gff-version 3
##sequence-region BBa_K741019 1 825
BBa_K741019	.	engineered_region	1	428	.	+	0	ID=BBa_K741016;Name=BBa_K741016
BBa_K741019	.	sequence_feature	91	291	.	+	0	ID=BBa_K741000;Name=BBa_K741000;Parent=BBa_K741016
BBa_K741019	.	terminator	300	428	.	+	0	ID=BBa_B0015;Name=BBa_B0015;Parent=BBa_K741016
BBa_K741019	.	terminator	300	379	.	+	0	ID=BBa_B0010;Name=BBa_B0010;Parent=BBa_B0015
BBa_K741019	.	engineered_region	300	379	.	+	0	ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010
BBa_K741019	.	stem_loop	311	354	.	+	0	ID=annotation4184;Name=stem_loop;Parent=BBa_B0010
BBa_K741019	.	terminator	388	428	.	+	0	ID=BBa_B0012;Name=BBa_B0012;Parent=BBa_B0015
BBa_K741019	.	stem_loop	395	414	.	+	0	ID=annotation1686;Name=T7 TE;Parent=BBa_B0012
BBa_K741019	.	stop_codon	421	421	.	+	0	ID=annotation1687;Name=stop;Parent=BBa_B0012
BBa_K741019	.	engineered_region	388	428	.	+	0	ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012
BBa_K741019	.	polyA_site	415	428	.	+	0	ID=annotation1690;Name=polya;Parent=BBa_B0012
BBa_K741019	.	promoter	1	82	.	+	0	ID=BBa_I12007;Name=BBa_I12007;Parent=BBa_K741016
BBa_K741019	.	non_covalent_binding_site	33	49	.	+	0	ID=annotation937702;Name=OR2;Parent=BBa_I12007
BBa_K741019	.	non_covalent_binding_site	9	25	.	+	0	ID=annotation937701;Name=OR1;Parent=BBa_I12007
BBa_K741019	.	sequence_alteration	59	65	.	+	0	ID=annotation937704;Name=mutate to obliterate OR3;Parent=BBa_I12007
BBa_K741019	.	promoter	48	53	.	+	0	ID=annotation937703;Name=-35;Parent=BBa_I12007
BBa_K741019	.	promoter	71	76	.	+	0	ID=annotation937705;Name=-10;Parent=BBa_I12007
BBa_K741019	.	engineered_region	437	825	.	+	0	ID=BBa_K741014;Name=BBa_K741014
BBa_K741019	.	promoter	437	518	.	+	0	ID=BBa_I12007;Name=BBa_I12007;Parent=BBa_K741014
BBa_K741019	.	non_covalent_binding_site	469	485	.	+	0	ID=annotation937702;Name=OR2;Parent=BBa_I12007
BBa_K741019	.	non_covalent_binding_site	445	461	.	+	0	ID=annotation937701;Name=OR1;Parent=BBa_I12007
BBa_K741019	.	sequence_alteration	495	501	.	+	0	ID=annotation937704;Name=mutate to obliterate OR3;Parent=BBa_I12007
BBa_K741019	.	promoter	484	489	.	+	0	ID=annotation937703;Name=-35;Parent=BBa_I12007
BBa_K741019	.	promoter	507	512	.	+	0	ID=annotation937705;Name=-10;Parent=BBa_I12007
BBa_K741019	.	engineered_region	527	825	.	+	0	ID=BBa_K741013;Name=BBa_K741013;Parent=BBa_K741014
BBa_K741019	.	terminator	697	825	.	+	0	ID=BBa_B0015;Name=BBa_B0015;Parent=BBa_K741013
BBa_K741019	.	terminator	697	776	.	+	0	ID=BBa_B0010;Name=BBa_B0010;Parent=BBa_B0015
BBa_K741019	.	engineered_region	697	776	.	+	0	ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010
BBa_K741019	.	stem_loop	708	751	.	+	0	ID=annotation4184;Name=stem_loop;Parent=BBa_B0010
BBa_K741019	.	terminator	785	825	.	+	0	ID=BBa_B0012;Name=BBa_B0012;Parent=BBa_B0015
BBa_K741019	.	stem_loop	792	811	.	+	0	ID=annotation1686;Name=T7 TE;Parent=BBa_B0012
BBa_K741019	.	stop_codon	818	818	.	+	0	ID=annotation1687;Name=stop;Parent=BBa_B0012
BBa_K741019	.	engineered_region	785	825	.	+	0	ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012
BBa_K741019	.	polyA_site	812	825	.	+	0	ID=annotation1690;Name=polya;Parent=BBa_B0012
BBa_K741019	.	CDS	545	688	.	+	0	ID=BBa_K117000;Name=BBa_K117000;Parent=BBa_K741013
BBa_K741019	.	ribosome_entry_site	527	538	.	+	0	ID=BBa_B0034;Name=BBa_B0034;Parent=BBa_K741013
BBa_K741019	.	conserved_region	531	534	.	+	0	ID=annotation23325;Name=conserved;Parent=BBa_B0034
>BBa_K741019
gcaaccattatcaccgccagaggtaaaatagtcaacacgcacggtgttagatatttataaatagtggtgatagatttaa
cgttactagagttatgctgttgtttttttgttactcgggaagggctttacctcttccgcataaacgcttccatcagcgt
ttatagttaaaaaaatctttcggcctgcatgaatggccttgttgatcgcgctttgatatacgccgagatctttagctgt
cttggtttgcccaaagcgcattgcataatctttcagggttatgcgttgttccattactagagccaggcatcaaataaaa
cgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactg
gctcaccttcgggtgggcctttctgcgtttatatactagaggcaaccattatcaccgccagaggtaaaatagtcaacac
gcacggtgttagatatttataaatagtggtgatagatttaacgttactagagaaagaggagaaatactagatgaaaaaa
ataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagg
gcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaatactagagccaggcatcaaataa
aacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacac
tggctcaccttcgggtgggcctttctgcgtttata