##gff-version 3 ##sequence-region BBa_K185030 1 357 ##sequence-region BBa_K676777 1 357 BBa_K185030 . promoter 138 337 . + 0 ID=BBa_R0010;Name=BBa_R0010 BBa_K185030 . non_covalent_binding_site 226 263 . + 0 ID=annotation1961223;Name=CAP binding site;Parent=BBa_R0010 BBa_K185030 . promoter 298 303 . + 0 ID=annotation1961225;Name=-10;Parent=BBa_R0010 BBa_K185030 . engineered_region 138 337 . + 0 ID=annotation1961222;Name=BBa_R0010;Parent=BBa_R0010 BBa_K185030 . CDS 138 225 . + 0 ID=annotation1961221;Name=end of LacI coding region (inactive);Parent=BBa_R0010 BBa_K185030 . non_covalent_binding_site 303 337 . + 0 ID=annotation1961226;Name=LacI binding site;Parent=BBa_R0010 BBa_K185030 . promoter 274 279 . + 0 ID=annotation1961224;Name=-35;Parent=BBa_R0010 BBa_K185030 . start_codon 310 310 . + 0 ID=annotation1961227;Name=start;Parent=BBa_R0010 BBa_K185030 . terminator 89 129 . + 0 ID=BBa_B0012;Name=BBa_B0012 BBa_K185030 . engineered_region 89 129 . + 0 ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012 BBa_K185030 . stem_loop 96 115 . + 0 ID=annotation1686;Name=T7 TE;Parent=BBa_B0012 BBa_K185030 . polyA_site 116 129 . + 0 ID=annotation1690;Name=polya;Parent=BBa_B0012 BBa_K185030 . stop_codon 122 122 . + 0 ID=annotation1687;Name=stop;Parent=BBa_B0012 BBa_K185030 . terminator 1 80 . + 0 ID=BBa_B0010;Name=BBa_B0010 BBa_K185030 . engineered_region 1 80 . + 0 ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010 BBa_K185030 . stem_loop 12 55 . + 0 ID=annotation4184;Name=stem_loop;Parent=BBa_B0010 BBa_K185030 . ribosome_entry_site 346 357 . + 0 ID=BBa_B0034;Name=BBa_B0034 BBa_K185030 . conserved_region 350 353 . + 0 ID=annotation23325;Name=conserved;Parent=BBa_B0034 BBa_K676777 . ribosome_entry_site 346 357 . + 0 ID=BBa_B0034;Name=BBa_B0034 BBa_K676777 . conserved_region 350 353 . + 0 ID=annotation23325;Name=conserved;Parent=BBa_B0034 BBa_K676777 . promoter 138 337 . + 0 ID=BBa_R0010;Name=BBa_R0010 BBa_K676777 . non_covalent_binding_site 226 263 . + 0 ID=annotation1961223;Name=CAP binding site;Parent=BBa_R0010 BBa_K676777 . promoter 298 303 . + 0 ID=annotation1961225;Name=-10;Parent=BBa_R0010 BBa_K676777 . engineered_region 138 337 . + 0 ID=annotation1961222;Name=BBa_R0010;Parent=BBa_R0010 BBa_K676777 . CDS 138 225 . + 0 ID=annotation1961221;Name=end of LacI coding region (inactive);Parent=BBa_R0010 BBa_K676777 . non_covalent_binding_site 303 337 . + 0 ID=annotation1961226;Name=LacI binding site;Parent=BBa_R0010 BBa_K676777 . promoter 274 279 . + 0 ID=annotation1961224;Name=-35;Parent=BBa_R0010 BBa_K676777 . start_codon 310 310 . + 0 ID=annotation1961227;Name=start;Parent=BBa_R0010 BBa_K676777 . terminator 1 129 . + 0 ID=BBa_B0015;Name=BBa_B0015 BBa_K676777 . terminator 89 129 . + 0 ID=BBa_B0012;Name=BBa_B0012;Parent=BBa_B0015 BBa_K676777 . engineered_region 89 129 . + 0 ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012 BBa_K676777 . stem_loop 96 115 . + 0 ID=annotation1686;Name=T7 TE;Parent=BBa_B0012 BBa_K676777 . polyA_site 116 129 . + 0 ID=annotation1690;Name=polya;Parent=BBa_B0012 BBa_K676777 . stop_codon 122 122 . + 0 ID=annotation1687;Name=stop;Parent=BBa_B0012 BBa_K676777 . terminator 1 80 . + 0 ID=BBa_B0010;Name=BBa_B0010;Parent=BBa_B0015 BBa_K676777 . engineered_region 1 80 . + 0 ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010 BBa_K676777 . stem_loop 12 55 . + 0 ID=annotation4184;Name=stem_loop;Parent=BBa_B0010 >BBa_K185030 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctct ctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcaatacgcaaaccgcctctcc ccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaat taatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtg agcggataacaatttcacacatactagagaaagaggagaaa >BBa_K676777 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctct ctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcaatacgcaaaccgcctctcc ccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaat taatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtg agcggataacaatttcacacatactagagaaagaggagaaa