##gff-version 3 ##sequence-region BBa_K176003 1 480 BBa_K176003 . sequence_alteration 172 173 . + 0 ID=annotation2008007;Name=at in K145151 BBa_K176003 . engineered_region 1 165 . + 0 ID=annotation2008000;Name=a part of lacZalpha (I732006) BBa_K176003 . stop_codon 475 480 . + 0 ID=annotation2008010;Name=Stop BBa_K176003 . primer_binding_site 21 37 . + 0 ID=annotation2008003;Name=M13 -20 primer BBa_K176003 . primer_binding_site 41 64 . + 0 ID=annotation2008004;Name=M13 -47 primer (K176059) BBa_K176003 . CDS 1 474 . + 0 ID=annotation2020665;Name=lacZalpha-ccdB BBa_K176003 . primer_binding_site 41 57 . + 0 ID=annotation2008005;Name=M13 -40 primer BBa_K176003 . start_codon 1 3 . + 0 ID=annotation2008001;Name=Start BBa_K176003 . engineered_region 172 477 . + 0 ID=annotation2008008;Name=ccdB (K145151) BBa_K176003 . point_mutation 255 255 . + 0 ID=annotation2008009;Name=c in K145151 BBa_K176003 . sequence_alteration 16 16 . + 0 ID=annotation2008002;Name=177bp and a in J32026 BBa_K176003 . point_mutation 165 165 . + 0 ID=annotation2008006;Name=g and 69bp in I732006 BBa_K176003 . primer_binding_site 188 215 . + 0 ID=annotation2011971;Name=VRccdB primer (K176058) >BBa_K176003 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatc gccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcg cagcctatacgtacggcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagt gatattattgacacgccggggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtg aactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgt tatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaata taataa