##gff-version 3 ##sequence-region BBa_J07040 1 515 BBa_J07040 . promoter 1 200 . + 0 ID=BBa_R0010;Name=BBa_R0010 BBa_J07040 . start_codon 173 173 . + 0 ID=annotation1961227;Name=start;Parent=BBa_R0010 BBa_J07040 . engineered_region 1 200 . + 0 ID=annotation1961222;Name=BBa_R0010;Parent=BBa_R0010 BBa_J07040 . promoter 161 166 . + 0 ID=annotation1961225;Name=-10;Parent=BBa_R0010 BBa_J07040 . CDS 1 88 . + 0 ID=annotation1961221;Name=end of LacI coding region (inactive);Parent=BBa_R0010 BBa_J07040 . promoter 137 142 . + 0 ID=annotation1961224;Name=-35;Parent=BBa_R0010 BBa_J07040 . non_covalent_binding_site 89 126 . + 0 ID=annotation1961223;Name=CAP binding site;Parent=BBa_R0010 BBa_J07040 . non_covalent_binding_site 166 200 . + 0 ID=annotation1961226;Name=LacI binding site;Parent=BBa_R0010 BBa_J07040 . mature_transcript_region 209 378 . + 0 ID=BBa_I1033;Name=BBa_I1033 BBa_J07040 . start_codon 269 271 . + 0 ID=annotation1898;Name=start;Parent=BBa_I1033 BBa_J07040 . start_codon 264 264 . + 0 ID=annotation1901;Name=start;Parent=BBa_I1033 BBa_J07040 . operator 209 263 . + 0 ID=annotation1902;Name=LacO-1;Parent=BBa_I1033 BBa_J07040 . sequence_feature 264 298 . + 0 ID=annotation1892;Name=Reverse Complement to cI mRNA;Parent=BBa_I1033 BBa_J07040 . stem_loop 287 307 . + 0 ID=annotation1893;Name=stem_loop;Parent=BBa_I1033 BBa_J07040 . stem_loop 266 328 . + 0 ID=annotation1899;Name=stem_loop;Parent=BBa_I1033 BBa_J07040 . sequence_alteration 266 268 . + 0 ID=annotation1900;Name=added codon (Cys);Parent=BBa_I1033 BBa_J07040 . engineered_region 209 378 . + 0 ID=annotation7053;Name=BBa_I1033;Parent=BBa_I1033 BBa_J07040 . sequence_feature 276 281 . + 0 ID=annotation1895;Name=Reverse Complement RBS;Parent=BBa_I1033 BBa_J07040 . sequence_feature 264 271 . + 0 ID=annotation1896;Name=reverse complement to cI cds;Parent=BBa_I1033 BBa_J07040 . terminator 387 466 . + 0 ID=BBa_B0010;Name=BBa_B0010 BBa_J07040 . stem_loop 398 441 . + 0 ID=annotation4184;Name=stem_loop;Parent=BBa_B0010 BBa_J07040 . engineered_region 387 466 . + 0 ID=annotation7018;Name=BBa_B0010;Parent=BBa_B0010 BBa_J07040 . terminator 475 515 . + 0 ID=BBa_B0012;Name=BBa_B0012 BBa_J07040 . engineered_region 475 515 . + 0 ID=annotation7020;Name=BBa_B0012;Parent=BBa_B0012 BBa_J07040 . polyA_site 502 515 . + 0 ID=annotation1690;Name=polya;Parent=BBa_B0012 BBa_J07040 . stem_loop 482 501 . + 0 ID=annotation1686;Name=T7 TE;Parent=BBa_B0012 BBa_J07040 . stop_codon 508 508 . + 0 ID=annotation1687;Name=stop;Parent=BBa_B0012 >BBa_J07040 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagc gggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggct cgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagataaatgtgagcggataacattgacattg tgagcggataacaagatactgagcacgagcacatcttgttgtctgattattgatttttcgcgaaaccatttgatcatat gacaagatgtgtatccaccttaacttaatgatttttaccaaaatcattaggggattcatcagtactagagccaggcatc aaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagag tcacactggctcaccttcgggtgggcctttctgcgtttata