##gff-version 3 ##sequence-region BBa_C2004 1 288 BBa_C2004 . tag 265 282 . + 0 ID=annotation1903896;Name=hexaHis tag BBa_C2004 . stop_codon 283 288 . + 0 ID=annotation1903900;Name=double stop codon BBa_C2004 . sequence_feature 151 177 . + 0 ID=annotation1903898;Name=domain linker BBa_C2004 . start_codon 1 3 . + 0 ID=annotation1903894;Name=start codon BBa_C2004 . non_covalent_binding_site 178 264 . + 0 ID=annotation1903899;Name=GCN4 homodimerization domain BBa_C2004 . non_covalent_binding_site 4 90 . + 0 ID=annotation1903893;Name=Finger 2 of Zif268 BBa_C2004 . non_covalent_binding_site 91 150 . + 0 ID=annotation1903897;Name=Finger 3 of Zif268 BBa_C2004 . CDS 1 288 . + 0 ID=annotation1903895;Name=Zif268.GCN4(-2) codon optimized >BBa_C2004 atgaaaccgttccagtgccgtatctgcatgcgtaacttctcccgttccgaccacctgaccacccacatccgtacccaca ccggtgaaaaaccgttcgcttgcgacatctgcggtcgtaaattcgctcgttccgacgaacgtaaacgtcaccgtgatat tcagcatattctgccgattctggaagacaaagttgaagaactgctgtccaaaaactaccacctggaaaacgaagttgct cgtctgaaaaaactggttggtgaacgtcatcaccatcaccatcactaataa